Microbial Genetics Exam 2 Fall 1999
Your Name:____________________
1. a) Chromosomal DNA of bacteria is (circle one) positively supercoiled/negatively supercoiled.
b) Of what advantage is it for the bacterium to have supercoiled DNA?
c) What enzymes are responsible for the state of supercoiling of bacterial DNA?
2. Compare and contrast the mechanism used by bacteria to coordinate the expression of related genes, with the mechanism used by eukaryotes.
3. a) What, in general terms, is a consensus sequence?
TAGGAAGACGACTACATGCT GAGGAGGTATCAACGGATGA CAGGAGAAGCGTCGAAATGC AAGGAGGATATGGTTTTATG
b) What is the consensus base
sequence in the 4 sequences to the right?
c) Where would you expect to find this consensus sequence?
4. Describe the initiation of DNA replication in bacteria. Be sure to include a description of how initiation of replication is coordinated with cell division.
5. Compare and contrast exon shuffling and alternative splicing.
6. Describe rho independent terminators, and explain how they work.
7. What is the difference between cDNA and genomic DNA? How do you isolate cDNA?
8. A mutation in a gene sequence changes the start codon to a stop codon. How will this mutation affect the transcription of this gene?
9. Briefly give the roles of the following in translation.
a) tRNA
b) 16S rRNA
c) aminoacyl-tRNA synthetases
d) release factors
e) E site
10. The his operon (hisABCD), which encodes the enzymes required for the biosynthesis of the amino acid histidine, is regulated by histidine. his(A-D) are structural genes.
a) Would you guess that histidine would inhibit or stimulate transcription of this operon? _____________________.
Explain your answer.
b) You have isolated two constitutive his mutants (call them hisXc and hisYc). What is the phenotype of these mutants (i.e., what does constitutive mean?)
Naturally, you make some merodiploids: hisX+ hisA- / hisXc hisA+ is constitutive for hisA.
hisX+ hisA+ / hisXc hisA- shows normal regulation phenotype for hisA.
hisY+ hisA+ / hisYc hisA- shows normal regulation phenotype for hisA
hisY+ hisA- / hisYc hisA+ also shows normal regulation of hisA
c) One of these mutations is in a gene for a repressor protein, and the other is in the his operator. Tell me which one is which, and explain your choice.